Skip to content

5.1 Add Nuclease Data Manually

Each row of the nuclease manifest represents a different nuclease mechanism. The most critical field is nuclease_type.

Steps

  1. Navigate to your created nuclease manifest.
  2. Select Create Record to add a new nuclease mechanism.
  3. Enter the fields described in the table below. nuclease_type, nuclease_mechanism, guide_sequence, and pam are mandatory; all other columns are optional. Refer to Example Manifest Data for a visual representation.
  4. To add further nuclease mechanisms, select + below the table or + Record in the upper-right corner.
  5. Continue adding records until all nuclease manifest data has been entered. Data saves automatically.

Manifest column reference

Column Description Example
nuclease_mechanism A unique, human-readable identifier for the nuclease mechanism. Referenced in the sample manifest to link samples to their nuclease treatment. cas9_PDCD1
nuclease_type Type of nuclease: cas9, cas12a, or custom. cas9
guide_sequence Protospacer sequence without the PAM. If the full guide is CACCTACCTAAGAACCATCCTGG, enter CACCTACCTAAGAACCATCC. CACCTACCTAAGAACCATCC
pam Guide length and PAM sequence. For Cas9: replace 3' PAM with NGG (e.g. 20-NGG). For Cas12a: replace 5' PAM with TTTV (e.g. TTTV-21). For custom: use X-PAM or PAM-X where X is the protospacer length. 20-NGG
sense_break Override position for the sense break. Specified as the base to the left of the cut. Leave blank to use nuclease defaults or to activate discovery mode (custom type). 17
antisense_break Override position for the antisense break. Leave blank as above. 18
cut_width_tolerance Integer added to the default merge distance. Example: if default merge distance is 4 and tolerance is 2, breaks within 6 bases are merged. 2
mismatch_threshold Maximum mismatches permitted for homology matching. Default is 6. Values above 6 are not recommended as they increase false-positive risk. 4

Understanding sense and antisense break positions

Positions are specified as the base to the left of the cut.

Blunt cut example:

T G C T A G G C | T A G T
A C G A T C C G | A T C A
1 2 3 4 5 6 7 8   9 10 11 12

sense_break = 8, antisense_break = 8

Staggered cut example:

T G C T A G | G C T A G T
A C G A T C C G A | T C A
1 2 3 4 5 6   7 8 9   10 11 12

sense_break = 6, antisense_break = 9