5.1 Add Nuclease Data Manually¶
Each row of the nuclease manifest represents a different nuclease mechanism. The most
critical field is nuclease_type.
Steps¶
- Navigate to your created nuclease manifest.
- Select Create Record to add a new nuclease mechanism.
- Enter the fields described in the table below.
nuclease_type,nuclease_mechanism,guide_sequence, andpamare mandatory; all other columns are optional. Refer to Example Manifest Data for a visual representation. - To add further nuclease mechanisms, select + below the table or + Record in the upper-right corner.
- Continue adding records until all nuclease manifest data has been entered. Data saves automatically.
Manifest column reference¶
| Column | Description | Example |
|---|---|---|
nuclease_mechanism |
A unique, human-readable identifier for the nuclease mechanism. Referenced in the sample manifest to link samples to their nuclease treatment. | cas9_PDCD1 |
nuclease_type |
Type of nuclease: cas9, cas12a, or custom. |
cas9 |
guide_sequence |
Protospacer sequence without the PAM. If the full guide is CACCTACCTAAGAACCATCCTGG, enter CACCTACCTAAGAACCATCC. |
CACCTACCTAAGAACCATCC |
pam |
Guide length and PAM sequence. For Cas9: replace 3' PAM with NGG (e.g. 20-NGG). For Cas12a: replace 5' PAM with TTTV (e.g. TTTV-21). For custom: use X-PAM or PAM-X where X is the protospacer length. |
20-NGG |
sense_break |
Override position for the sense break. Specified as the base to the left of the cut. Leave blank to use nuclease defaults or to activate discovery mode (custom type). | 17 |
antisense_break |
Override position for the antisense break. Leave blank as above. | 18 |
cut_width_tolerance |
Integer added to the default merge distance. Example: if default merge distance is 4 and tolerance is 2, breaks within 6 bases are merged. | 2 |
mismatch_threshold |
Maximum mismatches permitted for homology matching. Default is 6. Values above 6 are not recommended as they increase false-positive risk. |
4 |
Understanding sense and antisense break positions¶
Positions are specified as the base to the left of the cut.
Blunt cut example:
sense_break = 8, antisense_break = 8
Staggered cut example:
sense_break = 6, antisense_break = 9